pegfp n1 vector (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
pegfp n1 vector
Pegfp N1 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp+n1+vector/pcDNA3%2E1+puro+Nodamura+B2+(Plasmid+%2317228)/pmc12628023-87-13-16
Average 93 stars, based on 18 article reviews
Pegfp N1 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp+n1+vector/pcDNA3%2E1+puro+Nodamura+B2+(Plasmid+%2317228)/pmc12628023-87-13-16
Average 93 stars, based on 18 article reviews
pegfp n1 vector - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Amplification:Article Title: Mutation of CRYAB encoding a conserved mitochondrial chaperone and antiapoptotic protein causes hereditary optic atrophy Article Snippet: .. The full-length human CRYAB cDNAs were amplified with primers — 5′- CCGCTCGAGATGGACATCGCCAT -3′ (forward) and 5′- CGACCGGTGGGTATTTCTTGGGG -3′ (reverse) — and cloned into the XhoI and AgeI restriction sites of Clone Assay:Article Title: Mutation of CRYAB encoding a conserved mitochondrial chaperone and antiapoptotic protein causes hereditary optic atrophy Article Snippet: .. The full-length human CRYAB cDNAs were amplified with primers — 5′- CCGCTCGAGATGGACATCGCCAT -3′ (forward) and 5′- CGACCGGTGGGTATTTCTTGGGG -3′ (reverse) — and cloned into the XhoI and AgeI restriction sites of Article Title: Artesunate induces ferroptosis in gastric cancer by targeting the TFRC-HSPA9 axis for iron homeostasis regulation Article Snippet: .. To construct vectors for fluorescent protein expression, TFRC cDNA was inserted into the Plasmid Preparation:Article Title: Mutation of CRYAB encoding a conserved mitochondrial chaperone and antiapoptotic protein causes hereditary optic atrophy Article Snippet: .. The full-length human CRYAB cDNAs were amplified with primers — 5′- CCGCTCGAGATGGACATCGCCAT -3′ (forward) and 5′- CGACCGGTGGGTATTTCTTGGGG -3′ (reverse) — and cloned into the XhoI and AgeI restriction sites of Article Title: Structural insights into histone binding and nucleosome assembly by chromatin assembly factor-1 Article Snippet: .. Briefly, tandem copies of the 147-bp W601 DNA fragment were inserted into a Article Title: Aquaporins enriched in endothelial vacuole membrane regulate the diameters of microvasculature in hyperglycaemia. Article Snippet: . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Aquaporins enriched in endothelial vacuole membrane regulate the diameters of microvasculature in hyperglycaemia Article Title: Artesunate induces ferroptosis in gastric cancer by targeting the TFRC-HSPA9 axis for iron homeostasis regulation Article Snippet: .. To construct vectors for fluorescent protein expression, TFRC cDNA was inserted into the Article Title: Mechanism for controlled assembly of transcriptional condensates by Aire Article Snippet: .. For mGFP-p300 variant fusions, p300 variants were subcloned into a modified Recombinant:Article Title: Structural insights into histone binding and nucleosome assembly by chromatin assembly factor-1 Article Snippet: .. Briefly, tandem copies of the 147-bp W601 DNA fragment were inserted into a Produced:Article Title: Structural insights into histone binding and nucleosome assembly by chromatin assembly factor-1 Article Snippet: .. Briefly, tandem copies of the 147-bp W601 DNA fragment were inserted into a Cell Culture:Article Title: EF24, a Curcumin Analog, Reverses Interleukin-18-Induced miR-30a or miR-342-Dependent TRAF3IP2 Expression, RECK Suppression, and the Proinflammatory Phenotype of Human Aortic Smooth Muscle Cells Article Snippet: ASMCs were transfected with 80 nM of mimics or NC using the Neon ® Transfection System (MPK-5000; Invitrogen/Thermo Fisher Scientific, Waltham, MA, USA) using the following parameters: pulse voltage—1300 V; pulse width—20 ms; pulse number—2; the tip type—10 μL. .. They were then cultured for 24 h. The transfection efficiency of ASMC was ∼59% with 2% cell death, as determined using the Article Title: EF24, a Curcumin Analog, Reverses Interleukin-18-Induced miR-30a or miR-342-Dependent TRAF3IP2 Expression, RECK Suppression, and the Proinflammatory Phenotype of Human Aortic Smooth Muscle Cells. Article Snippet: ASMCs were transfected with 80 nM of mimics or NC using the Neon® Transfection System (MPK-5000; Invitrogen/Thermo Fisher Scientific, Waltham, MA, USA) using the following parameters: pulse voltage—1300 V; pulse width—20 ms; pulse number—2; the tip type—10μL. .. They were then cultured for 24 h. The transfection efficiency of ASMC was ∼59% with 2% cell death, as determined using the Transfection:Article Title: EF24, a Curcumin Analog, Reverses Interleukin-18-Induced miR-30a or miR-342-Dependent TRAF3IP2 Expression, RECK Suppression, and the Proinflammatory Phenotype of Human Aortic Smooth Muscle Cells Article Snippet: ASMCs were transfected with 80 nM of mimics or NC using the Neon ® Transfection System (MPK-5000; Invitrogen/Thermo Fisher Scientific, Waltham, MA, USA) using the following parameters: pulse voltage—1300 V; pulse width—20 ms; pulse number—2; the tip type—10 μL. .. They were then cultured for 24 h. The transfection efficiency of ASMC was ∼59% with 2% cell death, as determined using the Article Title: EF24, a Curcumin Analog, Reverses Interleukin-18-Induced miR-30a or miR-342-Dependent TRAF3IP2 Expression, RECK Suppression, and the Proinflammatory Phenotype of Human Aortic Smooth Muscle Cells. Article Snippet: ASMCs were transfected with 80 nM of mimics or NC using the Neon® Transfection System (MPK-5000; Invitrogen/Thermo Fisher Scientific, Waltham, MA, USA) using the following parameters: pulse voltage—1300 V; pulse width—20 ms; pulse number—2; the tip type—10μL. .. They were then cultured for 24 h. The transfection efficiency of ASMC was ∼59% with 2% cell death, as determined using the Construct:Article Title: Artesunate induces ferroptosis in gastric cancer by targeting the TFRC-HSPA9 axis for iron homeostasis regulation Article Snippet: .. To construct vectors for fluorescent protein expression, TFRC cDNA was inserted into the Expressing:Article Title: Artesunate induces ferroptosis in gastric cancer by targeting the TFRC-HSPA9 axis for iron homeostasis regulation Article Snippet: .. To construct vectors for fluorescent protein expression, TFRC cDNA was inserted into the Variant Assay:Article Title: Mechanism for controlled assembly of transcriptional condensates by Aire Article Snippet: .. For mGFP-p300 variant fusions, p300 variants were subcloned into a modified Modification:Article Title: Mechanism for controlled assembly of transcriptional condensates by Aire Article Snippet: .. For mGFP-p300 variant fusions, p300 variants were subcloned into a modified Mutagenesis:Article Title: Mechanism for controlled assembly of transcriptional condensates by Aire Article Snippet: .. For mGFP-p300 variant fusions, p300 variants were subcloned into a modified |